Uso de rizobacterias para el control de hongos fitopatógenos y promoción de crecimiento en plantas
DOI:
https://doi.org/10.59741/agraria.v3i1-2-3.528Keywords:
Bacillus subtilis, PCR, RhizosphereAbstract
Two bacteria strains were isolated of apple and vanilla rizósfera and was denominated (LPM1) and (LPM2) respectively; they were identified as Bacillus subtilis using an on-line biological system and the polymerase chain reaction technique, using the primers G-849 5' GCATATCGGTGTTAGTCCCGTCC 3' and G-850 5' TCGCTAGTAATCGCGGATCAGC 3'. They were determined characteristic as time of generation in two means of cultivations, infusion potato agar (IPA) and infusion potato agar sucrose (IPAS), being observed bigger cellular growth in IPAS and the time of generation of each bacteria was shorter with 0.74 h in IPAS that in IPA, where its time was 1.18 h. Difference was observed in the sensibility to antibiotics on the part of the stumps. In the thin layer chromatography the bands were obtained that faced with Fusarium sp. they reached 39.42 inhibition percent. B. subtilis produced siderophore like an action mechanism to inhibit mushrooms phytophatogens. The two stumps LPM1 and LPM2 showed enzymatic activity as proteasas, amylasas and casein. The evaluation of antagonism in vitro against Fusarium sp., Verticillium sp., Cephalosporium sp. and Dematophora sp., I reach an average of 26.51 inhibition percent for both stumps, where LPM1 obtained bigger effect with 39.3 percent against Verticillium sp. Also, the B. subtilis, presented capacity to promote the sorghum development, reaching bigger longitude and weight radicular. LPM1 stimulated but the growth of Sorghum and bean, showing superior values in longitude, weight radicular and fresh weight, although he/she behaved statistically similar to the treatment with LPM2.
Downloads
References
Abbass, Z. and Y. OKon. 1993. Plant growth promotion by Azotobacter paspali in the rhizosphere. Soil Biochem. 25:1075-1083. DOI: https://doi.org/10.1016/0038-0717(93)90156-6
Alcaraz, F and B. Visitin Gy Garcia. 1999. Selección in vitro de Bacillus spp como biocontroladores de Fusarium. Rev. Argent. Fitopatol. 34(2).
Baker, R., Y. Elad and Y. Chet. 1984. The controlled ex periment in the scientific method with special enphasis on biological control. Phytopathol. 74:1019-1021. DOI: https://doi.org/10.1094/Phyto-74-1019
Baker; K. F. 1987. Evolving concepts of biological control of plant pathogens. Ann. Rev. Phytopathol. 25:67-85. Bari, T and Y. Okin. 1993. Tryptophan conversion to in dole-3-acetic acid via indole-3-acetamida in Azospirillum brasilense Sp7. Can. J. Microbiol. 39:81- 86. DOI: https://doi.org/10.1139/m93-011
Barnett, H and B. Hunter. 1998. Illustrated genera of im perfect fungi. 3rd ed. APS Press, St. Paul, Minnesota, USA. 218 p.
Belimov, A. A., V. I. Safronova and T. Mimur. 2002. Re sponse of spring rape (Brassica napus var. olifera
L.) to inoculation with plant growth promoting rhizobacteria containing 1 aminocyclopropane-1-car boxylate deaminase depends on nutrient status of the plant. Can. J. Microbiol. 48:189-199. DOI: https://doi.org/10.1139/w02-007
Berge, O., J. Fages, D. Mulard and J. Balandreau. 1990. Effects of inoculation with Bacillus circulans and Azospirillum lipoferum on crop-yield in field growth maize. Symbiosis 9:259-266.
Besoon, F., C. Chevanet and G. Michel. 1987. Influence of the culture medium on the production of iturin A by Bacillus subtilis. J. Gen. Mocrobiol. 133:767-672. DOI: https://doi.org/10.1099/00221287-133-3-767
Bloemberg, G. V and B. J. J. Lugtenberg. 2001. Molecu lar basis of plant growth promotion and biocontrol by rhizobacteria. Curr. Opin. Plant Biol. 4:343-350. DOI: https://doi.org/10.1016/S1369-5266(00)00183-7
Cassan, F., R. Bottini, G. Schneider and P. Piccoli. 2001. Azospirillum brasilense and Azospirillum lipoferum hidrolyz conjugates of GA20 and metabolise that result ant aglycones to GA1in seedlings of rice dwarf mu tants. Plant Physiol. 125:2053-2058. DOI: https://doi.org/10.1104/pp.125.4.2053
Dashti, N., F. Zhang, R. Hynes and D. L. Smith. 1997. Plant and Soil.188, 33. DOI: https://doi.org/10.1023/A:1004295827311
Ferreira, J., F. N. Malthee and A. C. Thomas. 1991 Bio logical control of Eutypa lata on grapavine by a an tagonistic strain of Bacillus subtilis. Phytopathol. 81:283-287. DOI: https://doi.org/10.1094/Phyto-81-283
Fravel, D. R. 1988. Role of antibiosis in the biocontrol of plant diseases. Ann. Rev. Phytophatol. 26:75-91. Garcia de Salamone, I. E., R. K. Inés and L. M. Nelson. 2001. Cytokinin production by plant growth promoting rhizobacteria and selected mutants. Can J. Microbiol. 47:404-411. DOI: https://doi.org/10.1139/w01-029
Glick, B. R. 1995. The enhancenment of plant growth by free-living bacteria. Can. J. Microbiol. 41:109-117. Glick, B. R., C. L. Patten, O. Holguin and D. M. Penrose. DOI: https://doi.org/10.1139/m95-015
a. Biocontrol Mechanism. Chapter 7. pp. 86-133. In: Biochemical and genetic mechanism used by plant growth promoting bacteria. Imperial Collagge Press. Ontario, Canada.
Hernández, D. M y M. L. Charlloux. 2001. La nutrición mineral y la biofertilización en el cultivo del tomate (Lycopersicom esculentum Mill.) Temas Cien. Tecnol. 5:11-27.
Hernández, M. yA. Escalona. 2003. Microorganismos que benefician a las plantas: las bacterias PGPR. Revista de Divulgación Científica y Tecnológica de la Universidad Veracruzana. Veracruz. México. 16 (1).
Hong, Y., B. R. Glick and J. J. Pasternak. 1991. Plant microbial interaction under gnotobiotic conditions: A scanning electron microscope study. Current Microbiol. 23:111-114. DOI: https://doi.org/10.1007/BF02092259
Kloepper, J.W. 1991. Plant growth-promoting rhizobacteria as biological control agents of soilborne diseases. pp. 142-52. In: J. Bay-Peterson (Ed.) The biological con trol of plant diseases. Food and Fertilizer Technologi cal Center Taiwán.
Kloepper, J.W., R. Lifshitz and R. Zablotowicz. 1989. Free living bacterial inocula for enhancing crop productivity. Trends Biotecnol. 7:39-49. DOI: https://doi.org/10.1016/0167-7799(89)90057-7
Lagunas, L. J., Z. E. Mejia, O. S. Kawasoe y A. S. Ocampo. 2001. Bacillus firmus como agente de con trol biológico de Phytophthora capsici Leo. En jitomate (Lycopersicon esculentum Mill.). Rev. Mex. Fitopatol. 19 (1): 57-65.
Penrose, D. M and B. R. Glick. 2003. Methods for isola tion and characterization ACC deaminase-containing plant growth-promoting rhizobacteria. Physiol. Plant. 118:10-15. DOI: https://doi.org/10.1034/j.1399-3054.2003.00086.x
Pereira, J., A. R. Cavalcante, V. A. Baldani and J. Dobereiner. 1988. Sorghum and rice inoculation with
Azospirillum sp. Y Herbaspirillum seropedicae in field. Plant Soil. 110:269-274.
Podile, A. R and A. P. Prakash. 1996. Lysis and biological control of Aspergillus Níger by Bacillus subtilis AF-1. Can J. Microbiol. 42:533-538. DOI: https://doi.org/10.1139/m96-072
Schoroth, M. N and J. G. Hancock. 1981. Selected topics in biological control.Annu. Rev. Phytopathol. 35:453-476. Shah, S., J. Li, B. A. Moffatt and B. R.Glick. 1998. Isola tion and caracterization of ACC deaminase genes from two different plant growth promoting growth
rhizobacteria. Can. J. Microbiol. 44:833-843. Strenhoudt, O and J. Vanderleyden. 2000. Azospirillum, a free-living nitrogen-fixing bacterium closely associated with grasses; biochemical and ecological aspects. FEMS Microbiol. Rev. 24:487-506. DOI: https://doi.org/10.1111/j.1574-6976.2000.tb00552.x
Tapia-Hernández, A., M. A. Mascarua-Esparza and J. Caballero-Mellado. 1990. Production of bacteriocins and siderophore-like activity by Azospirillum brasilense. Microbios. 64:73-83.
Downloads
Published
Issue
Section
License

This work is licensed under a Creative Commons Attribution-ShareAlike 4.0 International License.
How to Cite
PLUMX Metrics
